What is the significance of using ampicillin in gene cloning

Plasmid stability was assayed either in the presence or absence of selection. The time zero cultures were grown and diluted as above at 24 and 48 h, and aliquots of the 48 h cultures were plated. Five independent clones of pUC19 and pFab were used to provide replicates.

Plasmid abundance was determined in two ways. Band intensities were determined by using ImageQuant software Amersham Biosciences. Primers amplifying the target gene 5'gtgctgcaaggcgattaagtt and 5' cactggccgtcgttttacaa , and reference gene 5'cgagaaactggcgatcctta and 5'cttcatcaagcggtttcaca were validated for similar amplification efficiencies.

Growth rates were calculated from the exponential phase of growth [ 28 ], which was monitored as increased OD over time by the VERSAmax spectrophotometer Molecular Devices. The host range of pFab within commonly used E. The growth rate at each arabinose concentration was calculated as described above. Threshold settings were enabled on forward scatter to exclude cell debris.

The forward and side scatter dot plot was used to identify and gate cell populations. Fluorescence was measured at nm. Viable and dead cell populations were counted using the Partec, FloMax software version 2. An aliquot of the diluted mixed culture was simultaneously plated onto selective and non-selective media for cell counts. This procedure was repeated 5 times over six days.

The numbers of ampicillin or triclosan resistant colonies were scored relative to the total CFUs. To test the potential of fabI as a selective marker for cloning, two vectors derived from pUC19 were constructed.

First, we constructed pFab, where fabI together with its native promoter replaces the ampicillin resistance gene bla in pUC As anticipated, fabI inserts enabled selection on triclosan containing plates.

Therefore, the fabI -triclosan system enables non-antibiotic selection and maintains stable recombinant strains. Vector construction and triclosan selection. A The bla gene in pUC19, which confers ampicillin resistance, was replaced with fabI and its promoter region pFab. All plasmids are available from the authors.

C Plasmids propagated in different E. To test whether fabI -triclosan selection could function well in other E. To test whether fabI can enable triclosan selection in other vectors, the pFab cassette was inserted into the multiple cloning site of pGEM-3Zf and also used to replace the ampicillin resistance gene in the low copy number vector pBR In both cases, triclosan resistant colonies were selected data not shown.

Therefore, the fabI -triclosan system enables efficient selection in commonly used vectors and E. In the absence of the inducer arabinose, no growth was observed in LBT broth, but growth rates increased with increasing arabinose concentrations up to 0. Therefore, pFab-mediated resistance to triclosan is due to expression of fabI. Effect of fabI induction on triclosan resistance.

Triclosan resistance mediated by arabinose-induced over-expression of fabI. Therefore, pFab displayed higher yield and copy number relative to the parent vector. Plasmid production of pFab transformants. To assess plasmid stability, we first scored the number of triclosan resistant colony forming units relative to total colony forming units.

This indicated high plasmid stability in the presence of triclosan, but some form of pFab-mediated toxicity in the absence of triclosan. Therefore, while pFab over-expression clearly conferred triclosan resistance, it also appeared to confer a requirement for the biocide.

To further investigate the interaction between fabI and triclosan, we first examined culture growth profiles. Similarly, we observed that the proportion of dead cells decreased with increasing triclosan concentrations.

The ratio of live to dead cells indicated by SYTOX staining was then quantified by flow cytometry [ 29 ]. Therefore, pFab is toxic but this toxicity is suppressed by triclosan. Effect of triclosan on growth, viability and fitness pFab transformants.

Growth rates were determined from the exponential phase, indicated by arrows. B Reduced fitness with fabI over-expression and its suppression by triclosan. The log10 ratio of plasmid-bearing cells to total number of cells against time represents the rate of plasmid loss in mixed cell populations.

The data is representative of two independent experiments. In other words, the rate of pFab loss was faster than pUC19 loss and therefore, in the absence of selection, pFab is less stable and less competitive than pUC We describe over-expression of a growth essential gene conferring resistance to a specific protein inhibitor as a plasmid selection system in E.

As well as avoiding the use of antibiotic resistance genes and antibiotics, pFab transformants showed improved growth, yield and gene containment. Leave a Reply Cancel reply. X We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work.

However you may visit Cookie Settings to provide a controlled consent. Manage consent. Close Privacy Overview We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. To find out more about cookies and how to manage cookies, read our Cookie Policy. If you are located in the EEA, the United Kingdom, or Switzerland, you can change your settings at any time by clicking Manage Cookie Consent in the footer of our website.

Necessary Necessary. Necessary cookies are absolutely essential for the website to function properly. These cookies ensure basic functionalities and security features of the website, anonymously. The cookie is used to store the user consent for the cookies in the category "Analytics". The cookie is used to store the user consent for the cookies in the category "Other. The cookies is used to store the user consent for the cookies in the category "Necessary".

The cookie is used to store the user consent for the cookies in the category "Performance". This cookie is used to check the status whether the user has accepted the cookie consent box.

It also helps in not showing the cookie consent box upon re-entry to the website. It does not store any personal data. Analytics analytics. Analytical cookies are used to understand how visitors interact with the website. These cookies help provide information on metrics the number of visitors, bounce rate, traffic source, etc.

This cookie is used to identify the repeat visit from a single user. Sitecore will send a persistent session cookie to the web client. This cookie is used by vimeo to collect tracking information. It sets a unique ID to embed videos to the website. WMF-Last-Access 1 month 18 hours 24 minutes This cookie is used to calculate unique devices accessing the website.

The cookie is used to calculate visitor, session, campaign data and keep track of site usage for the site's analytics report. The cookies store information anonymously and assign a randomly generated number to identify unique visitors. The cookie is used to store information of how visitors use a website and helps in creating an analytics report of how the website is doing.

The data collected including the number visitors, the source where they have come from, and the pages visted in an anonymous form. Marketing advertisement. Advertisement cookies are used to provide visitors with relevant ads and marketing campaigns. These cookies track visitors across websites and collect information to provide customized ads. Cookie Duration Description IDE 1 year 24 days Used by Google DoubleClick and stores information about how the user uses the website and any other advertisement before visiting the website.

To avoid such things from taking place, here are some tips that you may need to consider:. Avoid over-saturation. Always use fresh stocks or plates. Old stocks and plates may have reduced ampicillin concentration. Use a higher concentration. This will make it impossible for beta-lactamase to inactivate all of the ampicillin in your culture.

Take special precaution when preparing your starter culture. Remove all traces of beta-lactamase from the medium by pelleting and resuspending your starter culture in fresh, antibiotic-free medium prior to inoculating the main culture. Bacteria and yeast have been transformed with human genes to produce proteins that are useful in treating human diseases and disorders e.

Some bacteria have been modified such that they are able to digest oil from accidental spills. Bacteria are single-celled organisms that can easily pass information between one another and thus changes in genetic make-up are rapidly passed on to subsequent generations.

Transformation is usually more difficult with multicellular organisms, such as plants, in which it is necessary to either alter many cells with the new piece of DNA or to alter just a single cell and then induce it to produce a whole new plant. Genetic transformation of plants and other organisms does occur naturally. The bacterium you will be transforming, E. Its genetic material consists mostly of one large circle of DNA million base pairs mbp in length, with small loops of DNA called plasmids, usually ranging from 5,, base pairs in length, present in the cytoplasm.

It is these plasmids that bacteria can transfer back and forth, allowing them to share genes among one another and thus to naturally adapt to new environments. The ability of bacteria to maintain these plasmids and replicate them during normal cell multiplication is the basis of cell transformation.

In this experiment, green fluorescent protein GFP from the bioluminescent jellyfish Aequorea victoria has been incorporated into a plasmid along with a gene for resistance to the antibiotic ampicillin. The GFP is actually located in discrete spots around the bell margin of the jellyfish and will fluoresce under certain conditions When inserted into a plasmid and used for the transformation procedure, the transformed bacteria will express their newly acquired jellyfish gene and produce the fluorescent protein, which causes them to glow green under ultraviolet light.

This plasmid contains an ampicillin-resistance gene in addition to the GFP gene. Ampicillin is an antibiotic and works by preventing E. When the ampicillin-resistance gene is present, it directs the production of an enzyme that blocks the action of the ampicillin, and the bacteria are able to survive.

Bacteria without the plasmid and, hence, the resistance gene are unable to grow on a plate containing ampicillin in the medium, and only the transformants will survive. GFP is also used in research as a reporter molecule. It can be linked to the protein that you are interested in studying, and this protein can then be followed through changes in expression of the linked GFP. Review the safety instructions with your teacher to ensure that you know how to handle the cultures and equipment safely.

Clean the lab benches with the bleach solution and remember to wash your hands before leaving the lab. Stop Point: The tubes can be refrigerated overnight and removed just prior to the beginning of the next lab. If you will not finish the lab today, give the tubes to your teacher for overnight storage. Clean up: Place used loops etc in the bacterial waste container. Spray workspace with bleach solution and wipe with paper towels. Wash hands before leaving lab. Note: Factors influencing transformation efficiency include technique errors, the temperature and length of the incubation period, the growth stage of the cells, and using the correct mass of plasmid DNA.

The protocol above has been modified from UC Davis. The website below provides information and pictures of the transformation and regeneration of a tomato explant using Agrobacterium tumefaciens to carry the engineered DNA into the tomato cell.

Log In Bookstore Join Renew. It looks like your browser does not have JavaScript enabled. Please turn on JavaScript and try again.

Activity 4: Transformation of E.